Medigenomix provides extensive DNA
analytical services for various needs
in the fields of Life Sciences.

Veterinary Diagnostics / Breeder Services
Genotyping/Polymorphism Screening
Sex Determination
Sequencing, Gene Synthesis, Molecular Biology - Genomics & Bioinformatics
Food & Environment - Pharmacogenetics Genetic Risk Profiling Medical Studies

As of November 2003 we have been communicating with this specialized laboratory regarding genetics & dna information. Rainer Schubbert, Veterinary, PhD and Marc Müller, Public Relations have been very helpful. To visit the Medigenomix web site click on their banner above.

If you have any questions pertaining to the information on this page, please feel free to contact Rainer Schubbert, Veterinary, PhD as he is very knowledgeable and happy to help.
Click Here:
They have reviewed this page and concur with its accuracy.




As seen in the photos, the gene pool can have different outcomes in the same litter of cubs. In this article I will explain how the gene pool works in large cats.

Because we are not scientists, we will not go into the subject of genetics in depth. We will, however, offer some definitions to help explain the general idea.

There are three main ways of describing why the genetic diversity possessed by a species is essential to its long term survival:

Heterozygosity is positively related to fitness. The rate of evolutionary change able to occur in a group of organisms is dependent on the amount of genetic variation present in the gene pool.

The global pool of genetic information represents the "blueprint" for all life.

Although evidence has not produced unanimous results, there appears to be a correlation between the average heterozygosity of a group of animals and their average fitness. Fitness can be defined by the organism's ability to perform a long list of biological functions, and can be used as a measure of how succesful an organism is at exploiting its particular niche. Typically, organisms with a high fitness rating are very successful, and have many healthy offspring, while organisms with a low fitness value may not.

Heterozygosity is a measure of genetic difference within a population, and to some degree is a measure of the populations ability to withstand disaster. For example, the worlds entire human population is extremely diverse, and would have a high heterozygosity.

Breeding closely related animals reduces the level of heterozygosity in the offspring. When inbreeding occurs within a population rare genes can be lost, and the frequency of deleterious genes can increase or even become fixed, and overall genetic variability is reduced.

A classic example of this is the cheetah. All cheetahs are extremely closely related, and the level of heterozygosity within the entire cheetah population is of a similar order to that of brothers and sisters. Cheetahs are almost clones of each other. In fact, the entire cheetah population existing today is believed to be descended from one pregnant female that survived the last glacial period around five thousand years ago.

A typical outcome of inbreeding is called "inbreeding depression". Most organisms carry many deleterious alleles, but the affect of these are covered, or masked, by the individual also carrying a fully functioning copy of these alleles. In diverse population the chance of both parents giving a deleterious allele of the same gene to their offspring is minimal. When inbreeding occurs offspring may recieve deleterious alleles of a gene from each parent. Having two deleterious alleles for that gene means that they do not have a working copy of that gene, and this can reduce fitness or even be fatal.

Inbreeding depression is where deleterious alleles increase in frequency in the population, and variability decreases. The effects manifest as decreased fitness. Less offspring are born, and these have a lower chance of survival than previous generations, generally due to birth abnormalities. Inbreeding depression can, and generally does, lead to and cause extinction.

It appears that cheetahs have survived their period of inbreeding depression not by an influx of new individuals bearing genetic diversity (as there are none), and not by mutation causing increased variability (because not enough time has passed to allow their gene pool to naturally diversify to original levels), but by natural selection removing the deleterious genes from the gene pool. Individuals with a heavier lode of deleterious genes are outcompeted for food and mates by their healthier comrades, and do not pass their deleterious genes on.

It appears that cheetahs have survived the dangerous period of inbreeding depression, and, as a consequence, are now able to inbreed fairly succesfully, without as much danger of deleterious alleles manifesting. It seems that the cheetah population was recovering from the inbreeding event mentioned, but are again under threat as their numbers decrease.

One pitfall of low heterozygosity is the low genetic variability at immune loci. There are some diseases that the entire cheetah population have no resistance to, and when an individual contracts such a disease, it will die unless helped. In effect, the cheetah population is similar to a crop monoculture: we can protect them with some medicines, but they are vulnerable.

Where two animals are closely related, but different species mate, it is the male that will be sterile. This being the breeding of a hybrid animal. When two animals mate, the offspring that are homogametic sex will be fertile (XX females), while offspring that are heterogametic will be infertile.

"The opposite of inbreeding depression is outbreeding depression. This is where the animals involved aren't closely related enough, and there are compatability problems ... too much diversity. Examples of this are the mule, a cross between a horse and a donkey, and also goats and sheep, lions and tigers, and kangaroos and wallabies can be crossed. Different species can be crossed when they are closely related. The hybrid animal is only fertile if it is the homogametic XX female. Hybrids of the heterogametic sex (XY males) are always sterile, probably due to imcompatability of the sex chromosomes.

There have been many cases where endangered animals have been "rescued" by outbreeding. Populations with low heterozygosities can be given a genetic refreshment by introducing an individual from a distant population of the same species. Such individuals tend to have a sufficiently different genetic makeup to increase variation without causing outbreeding depression. Animal breeders do this often. There are many fancy chicken breeds, and these are created by people breeding unique looking animals with their siblings, so as to end up with a small population that is purebreeding for the desired trait. If a line becomes too inbred, they will cross it with something new, to refresh the gene pool, and then cross the best hybrid offspring back to the original stock for a few generations. They end up with an animal that looks like what they wanted, but has a broader gene pool.

All dog breeds were made this way, too. Every dog you see is actually an artifact of a human breeding program. All dogs came from the wolf, which had a huge population of great diversity. That doesn't mean that wolves looked like Great Danes and Chi Hua Hua's, it just means that the potential was there for them to develop that way. People simply inbred them until different alleles started manifesting, and unique looking individuals started appearing, and then concentrated on developing that unique trait. Inbreeding depression was avoided by occasional outbreeding.

As human development encroaches on the living space of all other large vertebrates we find that population numbers are always decreasing. This means that heterozygosity will be decreasing, as there are fewer individuals alive at any given time to carry that population's genetic diversity. As a result, diversity is lost, and inbreeding occurs.

Postulates at minumum population numbers have been made, but these vary with the characteristics of each species. Suggestions have been made that 500 individuals is the absolute lowest number a population can fall to, and still have diversity enough to withstand disaster (fire, flood), epidemic, and inbreeding depression successfully.

Many of the worlds great animals have populations lower than that, so breeding programs have been created to increase population numbers, and ensure that inbreeding is minimised. Outbreeding to increase diversity is not the only answer, though, because when outbreeding occurs the offspring is a hybrid. The identity of the hybrid is that of neither parent. It takes many generations of back crossing to regain the features of the species being "protected". Such programs are long term, and involve the danger of losing the species integrity. The answer is to never let population numbers get so low that such extreme measures need to be taken, but for many species it is too late for that. I guess the answer is complicated. There is a worldwide cooperative effort toward creating successful breeding programs which maintain genetic diversity, using captive animals from zoos and wild animals. Also there now exists a library of gametes (sperm and egg) from many species, frozen in liquid nitrogen for artificial insemination at "some later date", but this is not enough. Why have a population represented as gametes in a freezer when it could, and should be running about in the wild? Zoos and freezers do not make it O.K. to destroy habitat.

The cat population structure as it relates to territories; As far as cats go with their territories and the way females have smaller territories and males have larger ones, and how they overlap, and the fact that their lands are large, somtimes huge, it all leads towards inbreeding anyways. But they can handle it, it's the way they've been for millions of years. Cats generally have a lower heterozygosity equal to that of other animals it would mean that the males would have to wander vast territories, and offspring would have to be sired by males from either end of the continent.

Genetic variation enables a species to adapt and evolve to new circumstances. Alleles have been developed by the process of mutation and natural selection.

A special thanks to Brendan Duffy, a PhD student in molecular genetics from Melbourne, Australia. His input regarding this article and definitions have been very helpful.


TOP


DEFINITIONS
Alleles: Alleles are variant forms of a gene. For example; the "eye colour" gene may have three different alleles, one for blue eyes, one for brown eyes and one for grey eyes. A single allele is inherited separately from each parent, for each gene that we have. So each gene we have has a locus (a physical location on a chromosome), and at each locus we have two alleles, one from each parent. The two alleles for the "eye colour" gene that we have recieved from our parents will determine what colour our eyes will be.
Artificial
Insemination:
Impregnation of the female with seman from the male without direct sexual contact. This is an effective way of maintaining a breeding program.
Breed: To produce offspring.
Chromosomes: The self-replicating genetic structures inside each cell that contain the DNA that encodes all the genes that make the animal. The genomes of mammals consist of possibly one hundred thousand genes spread over a number of chromosomes. All our chromosomes come in pairs, one coming from each parent. Each chromosome pair is identical, or homologous, and contains the same genes at the same loci, along their length (although they may have different alleles for some genes). The only set of non-identical chromosomes is the sex chromosomes.
Deleterious: A deleterious allele of a gene may have a vital region deleted, or duplicated, or swapped for something else, so that the allele does not encode the product normally produced by that gene. This can lead to a loss of function for that gene, and can cause many difficulties for the organism. Generally, the effects of having one deleterious allele are covered by the allele inherited from the other.
DNA: DeoxyriboNucleic Acid is the molecule that encodes genetic information, and is the major constituent of the chromosomes. It is a linear molecule, so it can be read like a sentence. However, the genetic "alphabet" consists of only four different letters (called nucleotides), and not twenty-six. The nucleotides are A, G, T and C. A DNA sequence would look like the following: "ACCAAATGAATGCCTCTATTCATTCAAAAAAATCATCGGGCGGCG"
Gametes: Either of two mature reproductive cells, an ovum or sperm, which in uniting produce a zygote.
Gene: The fundamental physical and functional unit of heredity. A gene is an ordered sequence of DNA located at a particular locus (position) on a particular chromosome. Genes encode a specific functional product, such as a protein. A gene may have various alleles, which will encode variants of that protein, and are responsible for the genetic variation observed between individuals in the population.
Gene Families: Groups of closely related genes that make similar products. A prime example is the blood protein, "haemoglobin". The human haemoglobin gene family consists of many alternative forms of this protein, such as alpha, beta gamma and delta haemoglobins, all of which are similar, but have evolved a particular function relating to oxygen transport in the blood. This is not the same as alleles, these are actual extra genes, at new (but nearby) loci. Each member of this gene family (alpha, beta gamma and delta haemoglobin) has its own set of alleles.
Genetics: The study of the patterns of inheritance of specific traits.
Gene Pool: The available genetic potential within a given population. It is usually mentioned in relation to variation, or diversity within the population, such as a "big gene pool" (see heterozygosity).
Genome: The entire genetic compliment of an organism or species. The genome consists of all the heritable material, all the genes pertaining to a particular species, and is spread over a number of chromosomes. It can be measured in numbers of chromosomes, numbers of genes, or numbers of nucleotides (in this case called "base pairs").
Genotype: The genetic constitution of an organism or group of organisms. (Greek - genos, race, type)
Heterozygosity: A measure of the allelic variation within a population. Low heterozygosity means that there are only one or few alleles for most of the genes in that population's genome, so that many of the individuals within the population are similar or the same. High heterozygosity means that there are many variant alleles existing for the majority of genes in that population's genome, so that any two individuals are probably quite different. Low heterozygosity can mean that inbreeding has been occuring, or that the population in question was founded by a small group of individuals.
Heterozygous: Golden offspring that carry the recessive white gene. This term refers to the actual alleles of an individual. A heterozygous individual is one that has two differnet alleles for a given gene, that is, each parent contributed a different allele. An example is the eye colour gene. An individual with a "brown" allele and a "null" allele is heterozygous (Greek; hetero, different). The opposite of heterozygous is homozygous.
Homogeneous: Of same or similar nature or kind. Uniform in composition.
Homologous
Chromosomes:
A pair of identical chromosomes containing the same linear chromosomes: gene sequences (although they may have different alleles for some genes) each derived from one parent.
Homozygous: This refers to an individual that carries two identical alleles at a locus for a gene. A tiger which inherits a "brown" allele for the eye colour from each parent is homozygous for brown eyes.
Hybrid: The offspring of genetically disimilar parents especially of different varieties or species. (Latin - Hybrida)
Inbreed: To breed by the continued mating of closely related animals. This generally results in the inbred population having a lower heterozygosity than "wild" or naturally occurring populations, and can have dangerous affects.
Locus: The actual physical location on a chromosome of a gene or other chromosome marker. There are two alleles at any given locus, one coming from each parent, so each individual will have two alleles for each gene they have. "Locus" is sometimes used to mean "the regions of DNA that are expressed".
Melanism: The brownish black animal pigment contained in skin, hair, and other tissues. This is a recessive gene and will produce black babies.
Sex
Chromosomes:
All mammals have a pair of sex chromosomes, in addition to their ordinary chromosomes, or "autosomes". Females have two X chromosomes, while males have an X and a Y chromosome. It appears that all mammals will be female, and in fact begin foetal life as a female, unless there is a Y chromosome present to give the male development.
Nucleotide: An individual unit of the genetic code which DNA, alleles, genes and chromosomes are made from. All genetic information is contained in the arrangement of four different nucleotides (or bases, base-pairs). The nucleotides are Adenosine, Guanine, Thymine and Cytosine or AGTC. They are the four letter language used to form alleles, which are the various forms of our genes.
Species: A group of animals having in common certain attributes and designated by a common name. Members of a species can reproduce viable, fertile offspring. (From Latin - species, kind, form) a kind, variety or type.
Subspecies: Different animals that originated from a particular species. A concept similar to that of "race". Animals of different subspecies have some different characteristics, but still produce viable, fertile offspring when they mate.
Zygote: The product of the union of two gametes. An individual developing from such a union.
Some of the information gathered in this report was obtained via the internet. It is our belief that it is an accurate depiction of genetic basics.





HOME

SAFARI

GIFTS

TOP

BACK

NEXT